Tsetse GmmSRPN10 has anti-complement activity and is important for successful establishment of trypanosome infections in the fly midgut.

Primer sequences for β-tubulin were taken from [33] , while the primers for α-tubulin and GmmSRPN10 are: GmmSRPN10 Forward – TACTTCCAATTCGGCACCAG GmmSRPN10 Reverse – CCTGAATACGCAAACCTCGT Statistical analyses Non-parametric t-test and one way ANOVA were carried out with GraphPad Prism5, with P<0.05 considered significant and P<0.001 considered highly significant.

also in 132,142 other papers